|
Integrated DNA Technologies
cas9 espcas9 ![]() Cas9 Espcas9, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/Cas9+Nuclease/pmc09130532-88-6-21 Average 99 stars, based on 1 article reviews
cas9 espcas9 - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Addgene inc
specificity cas9 enzyme ![]() Specificity Cas9 Enzyme, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/eSpCas9(1%2E1)-T2A-Puro+(Plasmid+%23101039)/pmc08914325-327-5-13 Average 93 stars, based on 1 article reviews
specificity cas9 enzyme - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
crispr cas9 vector ![]() Crispr Cas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/eSpCas9(1%2E1)+(Plasmid+%2371814)/pmc10676593-180-21-26 Average 96 stars, based on 1 article reviews
crispr cas9 vector - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
GenScript corporation
gencrispr esp cas9 puro plasmid ![]() Gencrispr Esp Cas9 Puro Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/cas9+protein/pmc10359592-208-15-20 Average 90 stars, based on 1 article reviews
gencrispr esp cas9 puro plasmid - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Addgene inc
high specificity s pyogenes cas9 variant ![]() High Specificity S Pyogenes Cas9 Variant, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/SP-Cas9+(Plasmid+%2362731)/pmc09889345-73-11-24 Average 96 stars, based on 1 article reviews
high specificity s pyogenes cas9 variant - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
enhanced specificity cas9 plasmid espcas9(1.1) ![]() Enhanced Specificity Cas9 Plasmid Espcas9(1.1), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/sgrna+design+tool/pm36124643-256-12-27 Average 90 stars, based on 1 article reviews
enhanced specificity cas9 plasmid espcas9(1.1) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna cas9 expression plasmids ![]() Sgrna Cas9 Expression Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/eSpCas9(1%2E1)_No_FLAG_ATP1A1_G2_Dual_sgRNA+(Plasmid+%2386612)/pm41440036-363-5-9 Average 94 stars, based on 1 article reviews
sgrna cas9 expression plasmids - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
GenScript corporation
espcas9-2a-gfp ![]() Espcas9 2a Gfp, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/espcas9+2a+gfp+plasmid/pm36686648-63-9-11 Average 90 stars, based on 1 article reviews
espcas9-2a-gfp - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Addgene inc
cas9 delivery ![]() Cas9 Delivery, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/eSpCas9(1%2E1)_No_FLAG_AAVS1_T2+(Plasmid+%2379888)/pmc10619774-71-8-2 Average 93 stars, based on 1 article reviews
cas9 delivery - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Addgene inc
specificity cas9 plasmid ![]() Specificity Cas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/eSPCas9+(1%3A1)-2A-GFP+(Plasmid+%2382455)/bio_rxiv__2022__01__17__476620-122-12-28 Average 94 stars, based on 1 article reviews
specificity cas9 plasmid - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
GenScript corporation
plasmid esp-cas9-2a-gfp px458 ![]() Plasmid Esp Cas9 2a Gfp Px458, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cas9+espcas9/px458+exon20+grna+tagtccaggaggcagccgaa/pmc08677026-233-7-10 Average 90 stars, based on 1 article reviews
plasmid esp-cas9-2a-gfp px458 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Standard format: Plasmid sent in bacteria as agar stab
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: High-level correction of the sickle mutation is amplified in vivo during erythroid differentiation
doi: 10.1016/j.isci.2022.104374
Figure Lengend Snippet: Correction of the sickle mutation in long-term xenografted hematopoietic cells (A) Schematic depicting the β-globin gene ( HBB ) with the targeted region enlarged. Sequence shown in black is the sickle allele. The G10 guide RNA (red line) targets Cas9 cleavage to a site near the sickle mutation. The 168-base single-stranded DNA oligonucleotide donor induces sequence changes shown in red. HDR tract conversion proceeds from the Cas9 cleavage site (red arrow), alters the PAM motif to prevent cleavage of the edited allele, but does not always extend to the site of the sickle mutation. (B) Schematic outlining the large-scale xenografting experiment, and analysis of the engrafted cells.
Article Snippet: Wild-type Cas9 protein, Cas9 HF-1, and
Techniques: Mutagenesis, Sequencing
Journal: iScience
Article Title: High-level correction of the sickle mutation is amplified in vivo during erythroid differentiation
doi: 10.1016/j.isci.2022.104374
Figure Lengend Snippet: Assessment of off-target cleavage by the Cas9 RNP (A) Representative GUIDE-seq with the Cas9 RNP in K562 cells (left), and genomic coordinates of GUIDE-seq hits detected in three independent replicates (table at right). (B) Comparison of editing at HBB by high-fidelity Cas9 variants espCas9-1.1 and Alt-R HiFi Cas9 in healthydonor HSPCs. Error bars depict standard deviation from the mean. (C) GUIDE-seq in CD34 + HSPCs edited with the 3xMS-G10 RNP with wild-type Cas9. Only two sites, the on-target site in HBB and the primary off-target site OT1, are detected. (D) Representative GUIDE-seq with Alt-R HiFi Cas9 RNP in K562 cells. (E) Total gene editing rates (%HDR + %NHEJ) measured by pooled-primer PCR at 190 of 201 identified off-targets, in the edited HSPCs injected into Cohorts one and 2 (“input” in C), and in healthy donor HSPCs edited with Alt-R HiFi Cas9; indels observed at the same sites in untreated cells are subtracted. Blue dots: on-target HBB ; green dots: OT1; orange dots: OT-II. Editing at >0.2% of alleles (dashed line) by wild-type Cas9 is observed only at HBB , OT1, and OT-II, and by high-fidelity Cas9 only at HBB and OT1.
Article Snippet: Wild-type Cas9 protein, Cas9 HF-1, and
Techniques: Standard Deviation, Injection
Journal: iScience
Article Title: High-level correction of the sickle mutation is amplified in vivo during erythroid differentiation
doi: 10.1016/j.isci.2022.104374
Figure Lengend Snippet:
Article Snippet: Wild-type Cas9 protein, Cas9 HF-1, and
Techniques: Isolation, Recombinant, Mutagenesis, Sequencing, Software
Journal: The Journal of Biological Chemistry
Article Title: Recharacterization of the mammalian cytosolic type 2 ( R )-β-hydroxybutyrate dehydrogenase as 4-oxo- l -proline reductase (EC 1.1.1.104)
doi: 10.1016/j.jbc.2022.101708
Figure Lengend Snippet: Western blot analysis of BDH2 expression in four Bdh2 -deficient HEK293T clonal cell lines ( Bdh2 -KO) and WT HEK293T cells (WT). The KO clonal cell lines (A12, A15, B9, and B13) were generated by the CRISPR–Cas9 gene-inactivation procedure. The Western blot analysis was carried out using 40 μg of the cell lysate protein, a primary rabbit antibody against the human BDH2 (catalog no.: PA5-44760; Invitrogen), and a horseradish peroxidase–conjugated goat anti-rabbit secondary antibody. The secondary antibody was detected by measuring enhanced chemiluminescence. The presence of a nonspecific signal (≈30 kDa) is in agreement with the specification of the primary antibody. BDH2, type 2 ( R )-β-hydroxybutyrate dehydrogenase; HEK293T, human embryonic kidney 293T cell line.
Article Snippet: This vector encodes an enhanced
Techniques: Western Blot, Expressing, Generated, CRISPR
Journal: Clinical and Translational Medicine
Article Title: RIPK3–MLKL necroptotic signalling amplifies STING pathway and exacerbates lethal sepsis
doi: 10.1002/ctm2.1334
Figure Lengend Snippet: RIPK3 deficiency in HT‐29 cells restrains STING signalling. (A) Immunoblot analysis of ADU‐mediated STING signalling in HT‐29 cells transfected with RIPK3 encoding plasmids. The experiment was repeated at least three times. (B) Two RIPK3 knockout HT‐29 cell lines were selected by using the CRISPR/Cas9 system and immunoblot was conducted to verify RIPK3 knockout. (C) Western blot analysis of STING signalling in WT and RIPK3 knockout HT‐29 cells under ADU stimulation (27 µM). The experiment was repeated at least three times. (D) qPCR analysis of IFN‐β, ISG15, TNF‐α and IL‐6 in WT and RIPK3 knockout HT‐29 cells under ADU stimulation (27 µM). (E) Immunoblot analysis of ADU‐mediated STING signalling in RIPK3 knockout HT‐29 cells transfected with RIPK3 encoding plasmids. The experiment was repeated at least three times. (F) Assessment of DMXAA‐mediated IFN luciferase reporter activation in RAW264.3 cells stimulated with zVAD in a dose‐dependent manner. (G) Immunoblot analysis of STING signalling in WT and TBK1 knockout RAW264.7 cells treated with ADU (13.5 µM) and zVAD (30 µM). The experiment was repeated at least three times. Data were shown as the mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Article Snippet: Three Single‐guide RNA targeting the human RIPK3 gene (5′‐CAGTGTTCCGGGCGCAACAT‐3′, 5′‐CGCCTTTGCCGACGAGCTCC‐3′ and 5′‐GAATTCGTGCTGCGCCTAGA‐3′) was cloned into
Techniques: Western Blot, Transfection, Knock-Out, CRISPR, Luciferase, Activation Assay
Journal: Scientific Reports
Article Title: Rapid clonal identification of biallelic CRISPR/Cas9 knock-ins using SNEAK PEEC
doi: 10.1038/s41598-023-28732-8
Figure Lengend Snippet: Selecting biallelic CRISPR knock-ins using SNEAK PEEC ( a ) Transfection of a cell with two repair templates and Cas9 and guide RNA enables knock-in at the 3’ end of both alleles of a target gene. Each repair template encodes an identical tag (blue), 2A self-cleaving peptide (grey) and unique cell-surface display (purple or yellow). Biallelically edited cells in which each allele has been targeted using a different repair template express the tagged protein as well as both unique cell-surface displays. Upon expression, each surface display is exported to the cell surface and displayed extracellularly. The 2A self-cleaving peptide ensures bicistronic expression of the tagged target protein and surface display (lha and rha; left and right homology arms). ( b ) Timeline for SNEAK PEEC. Transfection (Day 1) followed by cell recovery and proliferation (Day 7). Cells are surface stained and sorted for single cell clones expressing both surface displays (Day 8). Clones are expanded (Days 9–23), followed by PCR screening to confirm the genomic integration of both repair templates (Day 24), and hence biallelic editing.
Article Snippet: A plasmid expressing a single guide RNA (sgRNA) together with a
Techniques: CRISPR, Transfection, Knock-In, Expressing, Cell Recovery, Staining, Clone Assay
Journal: PLOS ONE
Article Title: Pangenomic antiviral effect of REP 2139 in CRISPR/Cas9 engineered cell lines expressing hepatitis B virus surface antigen
doi: 10.1371/journal.pone.0293167
Figure Lengend Snippet: (A) Map of the plasmid used for CRISPR/Cas9 insertion of HBsAg from variant genotypes and HBx. (B) Chromosome 19 (Chr 19) modified to the insertion site by insert of the transgene. The left homology-arm (HA-L) and the puromycin resistance gene from plasmid described in A are represented. Experimental design on this gDNA is as shown, primers attachment sites are indicated in red arrows, and the restriction site of BglII is also indicated. (C) Agarose gel presenting the PCR amplification product of the insertion site. (D) Agarose gel presenting the BglII digested PCR product.
Article Snippet: Plasmid eSpCas9(1.1)_No_FLAG_AAVS1_T2 (
Techniques: Plasmid Preparation, CRISPR, Variant Assay, Modification, Agarose Gel Electrophoresis, Amplification